The average Tm used for this computation is 74.5


Hybridization Map:
(Upper (+) strand is given 5' - 3', lower (-) strand is 3' - 5'. Numbers are hybridization Tm ([DNA] = 1.0000000000000002E-6 M, [Na+] = 1.0 M))

ACCATGATTACGGATTCACTGGC-CGTCGTTTTACAACGTCGTG ACTGGGAAAACCCTGGC-GTTACCCAACTTAATCG
TGGTACTAATGCCTAAGTGACCG GCAGCAAAATGTTGCAGCAC-TGACCCTTTTGGGACCG CAATGGGTTGAATTAGC
72.69                   70.96                71.14             70.8             

CCTTG CAGCACATCCCCCTTTCG-CCAGCTGGCGTAATAGCG AAGAGGCCCGCACCGA-TCGCCCTTCCCAACAGT T
GGAAC-GTCGTGTAGGGGGAAAGC GGTCGACCGCATTATCGC-TTCTCCGGGCGTGGCT AGCGGGAAGGGTTGTCA-A
      72.08              72.02              75.51            72.64             7

GCGCAGCCTGAATGG-CGAATGGCGCTTTGCC TGGTTTCCGGCACCAG-AAGCGGTGCCGGAAAG CTGGCTGGAGTGC
CGCGTCGGACTTACC GCTTACCGCGAAACGG-ACCAAAGGCCGTGGTC TTCGCCACGGCCTTTC-GACCGACCTCACG
1.81            70.82            70.99            71.68            71.39        

GATC-TTCCTGAGGCCGATACTGT CGTCGTCCCCTCAAACTGG-CAGATGCACGGTTACGATGC GCCCATCTACACCA
CTAG AAGGACTCCGGCTATGACA-GCAGCAGGGGAGTTTGACC GTCTACGTGCCAATGCTACG-CGGGTAGATGTGGT
     71.92               74.1                72.96                70.73         

ACGTA-ACCTATCCCATTACGGTCAATC CGCCGTTTGTTCCCACG-GAGAATCCGACGGGTTGTTA CTCGCTCACATT
TGCAT TGGATAGGGTAATGCCAGTTAG-GCGGCAAACAAGGGTGC CTCTTAGGCTGCCCAACAAT-GAGCGAGTGTAA
      70.98                  73.0              70.96                70.90       

TAATGTTGATGA-AAGCTGGCTACAGGAAGGC CAGACGCGAATTATTTTTGATGGC-GTTAACTCGGCGTTTCATCTG
ATTACAACTACT TTCGACCGATGTCCTTCCG-GTCTGCGCTTAATAAAAACTACCG CAATTGAGCCGCAAAGTAGAC-
             73.82               72.6                     70.73                 

TGGTGCAACGGGCGCT-GGGTCGGTTACGGCCA GGACAGTCGTTTGCCGT-CTGAATTTGACCTGAGCGCA TTTTTAC
ACCACGTTGCCCGCGA CCCAGCCAATGCCGGT-CCTGTCAGCAAACGGCA GACTTAAACTGGACTCGCGT-AAAAATG
77.14            73.03            71.47             72.42                70.85  

GCGCCGGAGA-AAACCGCCTCGCGGTG ATGGTGCTGCGTTGGA-GTGACGGCAGTTATCTGGA AGATCAGGATATGTG
CGCGGCCTCT TTTGGCGGAGCGCCAC-TACCACGACGCAACCT CACTGCCGTCAATAGACCT-TCTAGTCCTATACAC
           74.60            70.66            70.68               72.0           

GCGGA-TGAGCGGCATTTTCCGT GACGTCTCGTTGCTGCA-TAAACCGACTACACAAATCAGCG ATTTCCATGTTGCC
CGCCT ACTCGCCGTAAAAGGCA-CTGCAGAGCAACGACGT ATTTGGCTGATGTGTTTAGTCGC-TAAAGGTACAACGG
      71.33             71.39             72.40                   73.12         

ACTCGC-TTTAATGATGATTTCAGCCGCG CTGTACTGGAGGCTGAAGTT-CAGATGTGCGGCGAGT TGCGTGACTACC
TGAGCG AAATTACTACTAAAGTCGGCGC-GACATGACCTCCGACTTCAA GTCTACACGCCGCTCA-ACGCACTGATGG
       71.21                  70.6                 70.93            72.39       

TACGGG-TAACAGTTTCTTTATGGCAGGGT GAAACGCAGGTCGCCAG-CGGCACCGCGCCTTTC GGCGGTGAAATTAT
ATGCCC ATTGTCAAAGAAATACCGTCCCA-CTTTGCGTCCAGCGGTC GCCGTGGCGCGGAAAG-CCGCCACTTTAATA
       71.63                   72.51             75.9             73.2          

CGATGAGC-GTGGTGGTTATGCCGATCG CGTCACACTACGTCTGAACG-TCGAAAACCCGAAACTGTGG AGCGCCGAA
GCTACTCG CACCACCAATACGGCTAGC-GCAGTGTGATGCAGACTTGC AGCTTTTGGGCTTTGACACC-TCGCGGCTT
         72.26               71.75                72.28                73.06    

ATCCCGA-ATCTCTATCGTGCGGTGGT TGAACTGCACACCGCC-GACGGCACGCTGATTGA AGCAGAAGCCTGCGATG
TAGGGCT TAGAGATAGCACGCCACCA-ACTTGACGTGTGGCGG CTGCCGTGCGACTAACT-TCGTCTTCGGACGCTAC
        72.20               71.58            71.56             71.42            

-TCGGTTTCCGCGAGGT GCGGATTGAAAATGGTCTGC-TGCTGCTGAACGGCAA GCCGTTGCTGATTCGAGG-CGTTA
AGCCAAAGGCGCTCCA-CGCCTAACTTTTACCAGACG ACGACGACTTGCCGTT-CGGCAACGACTAAGCTCC GCAAT
 72.52            71.49                71.25            72.5               71.34

ACCGTCACGAGCA TCATCCTCTGCATGGTCAG-GTCATGGATGAGCAGACGA TGGTGCAGGATATCCTGC-TGATGAA
TGGCAGTGCTCGT-AGTAGGAGACGTACCAGTC CAGTACCTACTCGTCTGCT-ACCACGTCCTATAGGACG ACTACTT
              70.53               70.72               70.61              71.22  

GCAGAACAACTTTAACG CCGTGCGCTGTTCGCA-TTATCCGAACCATCCGCTG TGGTACACGCTGTGCG-ACCGCTAC
CGTCTTGTTGAAATTGC-GGCACGCGACAAGCGT AATAGGCTTGGTAGGCGAC-ACCATGTGCGACACGC TGGCGATG
                  75.10            71.12               71.1             71.58   

GGCCTGTA TGTGGTGGATGAAGCCAA-TATTGAAACCCACGGCATGG TGCCAATGAATCGTCTGACC-GATGATCCGC
CCGGACAT-ACACCACCTACTTCGGTT ATAACTTTGGGTGCCGTACC-ACGGTTACTTAGCAGACTGG CTACTAGGCG
         70.73              72.34                71.9                 72.19     

GCTGGC TACCGGCGATGAGCGA-ACGCGTAACGCGAATGG TGCAGCGCGATCGTAA-TCACCCGAGTGTGATCATCT
CGACCG-ATGGCCGCTACTCGCT TGCGCATTGCGCTTACC-ACGTCGCGCTAGCATT AGTGGGCTCACACTAGTAGA-
       71.90            72.12             70.51            72.12                

GGTCGCTGGGGAATGAA-TCAGGCCACGGCGCTA ATCACGACGCGCTGTATC-GCTGGATCAAATCTGTCGATCC TTC
CCAGCGACCCCTTACTT AGTCCGGTGCCGCGAT-TAGTGCTGCGCGACATAG CGACCTAGTTTAGACAGCTAGG-AAG
70.               75.43            71.24              72.48                  76.

CCGCCCGGTGCAG-TATGAAGGCGGCGGAGC CGACACCACGGCCACC-GATATTATTTGCCCGATGTACGC GCGCGTG
GGCGGGCCACGTC ATACTTCCGCCGCCTCG-GCTGTGGTGCCGGTGG CTATAATAAACGGGCTACATGCG-CGCGCAC
89            73.70             74.              71.08                   72.28  

GATGAAGACC-AGCCCTTCCCGGCTGT GCCGAAATGGTCCATCAAAA-AATGGCTTTCGCTACCTGG AGAGACGCGCC
CTACTTCTGG TCGGGAAGGGCCGACA-CGGCTTTACCAGGTAGTTTT TTACCGAAAGCGATGGACC-TCTCTGCGCGG
           75.41            70.64                71.75               76.57      

CGCTG-ATCCTTTGCGAATACGCCC ACGCGATGGGTAACAGTC-TTGGCGGTTTCGCTAAATACT GGCAGGCGTTTCG
GCGAC TAGGAAACGCTTATGCGGG-TGCGCTACCCATTGTCAG AACCGCCAAAGCGATTTATGA-CCGTCCGCAAAGC
      72.08               70.94              71.86                 71.5         

TCA-GTATCCCCGTTTACAGGGC GGCTTCGTCTGGGACTG-GGTGGATCAGTCGCTGATTA AATATGATGAAAACGGC
AGT CATAGGGGCAAATGTCCCG-CCGAAGCAGACCCTGAC CCACCTAGTCAGCGACTAAT-TTATACTACTTTTGCCG
    71.48               70.96             70.80                71.03            

AACCC-GTGGTCGGCTTACGGC GGTGATTTTGGCGATACGC-CGAACGATCGCCAGTTCT GTATGAACGGTCTGGTCT
TTGGG CACCAGCCGAATGCCG-CCACTAAAACCGCTATGCG GCTTGCTAGCGGTCAAGA-CATACTTGCCAGACCAGA
      71.63            70.88               71.                72.79             

TTGC-CGACCGCACGCCGCAT CCAGCGCTGACGGAAG-CAAAACACCAGCAGCAGTT TTTCCAGTTCCGTTTATCCGG
AACG GCTGGCGTGCGGCGTA-GGTCGCGACTGCCTTC GTTTTGTGGTCGTCGTCAA-AAAGGTCAAGGCAAATAGGCC
     77.81            71.60            70.7                71.86                

-GCAAACCATCGAAGTGACCAG CGAATACCTGTTCCGTCATAGC-GATAACGAGCTCCTGCACT GGATGGTGGCGCTG
CGTTTGGTAGCTTCACTGGTC-GCTTATGGACAAGGCAGTATCG CTATTGCTCGAGGACGTGA-CCTACCACCGCGAC
 73.14                 72.                    70.73               73.90         

GAT-GGTAAGCCGCTGGCAAG CGGTGAAGTGCCTCTGG-ATGTCGCTCCACAAGGTAAA CAGTTGATTGAACTGCCTG
CTA CCATTCGGCGACCGTTC-GCCACTTCACGGAGACC TACAGCGAGGTGTTCCATTT-GTCAACTAACTTGACGGAC
    72.40             71.29             71.00                72.45              

AACTA-CCGCAGCCGGAGAGCG CCGGGCAACTCTGGCTC-ACAGTACGCGTAGTGCAACC GAACGCGACCGCATGGT-
TTGAT GGCGTCGGCCTCTCGC-GGCCCGTTGAGACCGAG TGTCATGCGCATCACGTTGG-CTTGCGCTGGCGTACCA
      77.26            74.32             74.12                74.72             

CAGAAGCCGGGCACATC AGCGCCTGGCAGCAGTG-GCGTCTGGCGGAAAACC TCAGTGTGACGCTCCCCG-CCGCGTC
GTCTTCGGCCCGTGTAG-TCGCGGACCGTCGTCAC CGCAGACCGCCTTTTGG-AGTCACACTGCGAGGGGC GGCGCAG
72.11             77.49             72.89             75.73              77.12  

CCACGCCAT CCCGCATCTGACCACC-AGCGAAATGGATTTTTGCATCG AGCTGGGTAATAAGCGTTGG-CAATTTAAC
GGTGCGGTA-GGGCGTAGACTGGTGG TCGCTTTACCTAAAAACGTAGC-TCGACCCATTATTCGCAACC GTTAAATTG
          71.11            71.99                  71.72                70.5     

CGCCAGTCAGG CTTTCTTTCACAGATGTGGATTGG-CGATAAAAAACAACTGCTGACGC CGCTGCGCGATCAGTT-CA
GCGGTCAGTCC-GAAAGAAAGTGTCTACACCTAACC GCTATTTTTTGTTGACGACTGCG-GCGACGCGCTAGTCAA GT
            71.40                    72.43                   71.91            75

CCCGTGCACCGCTG GATAACGACATTGGCGTAAGTG-AAGCGACCCGCATTGA CCCTAACGCCTGGGTCG-AACGCTG
GGGCACGTGGCGAC-CTATTGCTGTAACCGCATTCAC TTCGCTGGGCGTAACT-GGGATTGCGGACCCAGC TTGCGAC
.26            70.81                  70.64            73.61             74.77  

GAAGGCGGC GGGCCATTACCAGGCC-GAAGCAGCGTTGTTGCAG TGCACGGCAGATACACTT-GCTGATGCGGTGCTG
CTTCCGCCG-CCCGGTAATGGTCCGG CTTCGTCGCAACAACGTC-ACGTGCCGTCTATGTGAA CGACTACGCCACGAC
          71.38            71.27              70.65              71.37          

A TTACGACCGCTCACGC-GTGGCAGCATCAGGGG AAAACCTTATTTATCAGCCGGAAA-ACCTACCGGATTGATGGTA
T-AATGCTGGCGAGTGCG CACCGTCGTAGTCCCC-TTTTGGAATAAATAGTCGGCCTTT TGGATGGCCTAACTACCAT
  70.75            71.59            70.51                    71.95              

GT GGTCAAATGGCGATTACCGT-TGATGTTGAAGTGGCGAGC GATACACCGCATCCGGC-GCGGATTGGCCTGAACT
CA-CCAGTTTACCGCTAATGGCA ACTACAACTTCACCGCTCG-CTATGTGGCGTAGGCCG CGCCTAACCGGACTTGA-
   72.24                72.1                71.80             71.47             

GCCAGCTGGCGCAGGTA-GCAGAGCGGGTAAACTGG CTCGGATTAGGGCCGC-AAGAAAACTATCCCGACCGC CTTAC
CGGTCGACCGCGTCCAT CGTCTCGCCCATTTGACC-GAGCCTAATCCCGGCG TTCTTTTGATAGGGCTGGCG-GAATG
76.91             71.97              70.83            71.62                70.76

TGCCGCCTGTTTTG-ACCGCTGGGATCTGCC ATTGTCAGACATGTATACCCCG-TACGTCTTCCCGAGCGA AAACGGT
ACGGCGGACAAAAC TGGCGACCCTAGACGG-TAACAGTCTGTACATATGGGGC ATGCAGAAGGGCTCGCT-TTTGCCA
               73.26            71.18                  71.37             72.2   

CTGCGCTGC-GGGACGCGCGAATTGA ATTATGGCCCACACCAGTGG-CGCGGCGACTTCCAGTT CAACATCAGCCGCT
GACGCGACG CCCTGCGCGCTTAACT-TAATACCGGGTGTGGTCACC GCGCCGCTGAAGGTCAA-GTTGTAGTCGGCGA
          71.62            74.1                 74.35             72.39         

ACAGTC-AACAGCAACTGATGGAAACCAG CCATCGCCATCTGCTGCA-CGCGGAAGAAGGCACAT GGCTGAATATCGA
TGTCAG TTGTCGTTGACTACCTTTGGTC-GGTAGCGGTAGACGACGT GCGCCTTCTTCCGTGTA-CCGACTTATAGCT
       72.88                  74.57              71.68             73.99        

CGGTTTCCATA-TGGGGATTGGTGGCGAC GACTCCTGGAGCCCGTC-AGTATCGGCGGAATTCCAGC TGAGCGCCGGT
GCCAAAGGTAT ACCCCTAACCACCGCTG-CTGAGGACCTCGGGCAG TCATAGCCGCCTTAAGGTCG-ACTCGCGGCCA
            73.77             72.9              73.96                76.2       

CGCTAC-CATTACCAGTTGGTCTGGTGTC AAAAATAATAATAAcggctgccgt-ggtagtatagggtgatgggca
GCGATG GTAATGGTCAACCAGACCACAG-TTTTTATTATTATTgccgacggca ccatcatatcccactacccgt
       72.33                  71.03                    72.3                 


Statistics:
Min Tm is 70.0 °C
Avg Tm is 72.33 °C
Max Tm is 77.81 °C
Min hybridization unit size is 16 nucleotides
Avg hybridization unit size is 18.5 nucleotides
Max hybridization unit size is 24 nucleotides


Oligonucleotides to be synthesized:
(All sequence are 5'- 3'. R stand for reverse or (-) strand, F for forward or (+) strand. Sequence in lower case is extra sequence used for termination and does not belong to the input sequence)

R0      GCCAGTGAATCCGTAATCATGGT
F0      ACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTG
R23     GCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACG
F43     ACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTG
R60     CGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAAC
F82     CAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCG
R100    TCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGG
F118    AAGAGGCCCGCACCGATCGCCCTTCCCAACAGT
R134    CCATTCAGGCTGCGCAACTGTTGGGAAGGGCGA
F151    TGCGCAGCCTGAATGGCGAATGGCGCTTTGCC
R167    CTGGTGCCGGAAACCAGGCAAAGCGCCATTCG
F183    TGGTTTCCGGCACCAGAAGCGGTGCCGGAAAG
R199    GATCGCACTCCAGCCAGCTTTCCGGCACCGCTT
F215    CTGGCTGGAGTGCGATCTTCCTGAGGCCGATACTGT
R232    CCAGTTTGAGGGGACGACGACAGTATCGGCCTCAGGAA
F251    CGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGC
R270    TACGTTGGTGTAGATGGGCGCATCGTAACCGTGCATCTG
F290    GCCCATCTACACCAACGTAACCTATCCCATTACGGTCAATC
R309    CGTGGGAACAAACGGCGGATTGACCGTAATGGGATAGGT
F331    CGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTA
R348    TCATCAACATTAAATGTGAGCGAGTAACAACCCGTCGGATTCTC
F368    CTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGC
R392    GCCATCAAAAATAATTCGCGTCTGGCCTTCCTGTAGCCAGCTT
F411    CAGACGCGAATTATTTTTGATGGCGTTAACTCGGCGTTTCATCTG
R435    AGCGCCCGTTGCACCACAGATGAAACGCCGAGTTAAC
F456    TGGTGCAACGGGCGCTGGGTCGGTTACGGCCA
R472    ACGGCAAACGACTGTCCTGGCCGTAACCGACCC
F488    GGACAGTCGTTTGCCGTCTGAATTTGACCTGAGCGCA
R505    TCTCCGGCGCGTAAAAATGCGCTCAGGTCAAATTCAG
F525    TTTTTACGCGCCGGAGAAAACCGCCTCGCGGTG
R542    TCCAACGCAGCACCATCACCGCGAGGCGGTTT
F558    ATGGTGCTGCGTTGGAGTGACGGCAGTTATCTGGA
R574    TCCGCCACATATCCTGATCTTCCAGATAACTGCCGTCAC
F593    AGATCAGGATATGTGGCGGATGAGCGGCATTTTCCGT
R613    TGCAGCAACGAGACGTCACGGAAAATGCCGCTCA
F630    GACGTCTCGTTGCTGCATAAACCGACTACACAAATCAGCG
R647    GCGAGTGGCAACATGGAAATCGCTGATTTGTGTAGTCGGTTTA
F670    ATTTCCATGTTGCCACTCGCTTTAATGATGATTTCAGCCGCG
R690    AACTTCAGCCTCCAGTACAGCGCGGCTGAAATCATCATTAAA
F712    CTGTACTGGAGGCTGAAGTTCAGATGTGCGGCGAGT
R732    CCCGTAGGTAGTCACGCAACTCGCCGCACATCTG
F748    TGCGTGACTACCTACGGGTAACAGTTTCTTTATGGCAGGGT
R766    CTGGCGACCTGCGTTTCACCCTGCCATAAAGAAACTGTTA
F789    GAAACGCAGGTCGCCAGCGGCACCGCGCCTTTC
R806    GCTCATCGATAATTTCACCGCCGAAAGGCGCGGTGCCG
F822    GGCGGTGAAATTATCGATGAGCGTGGTGGTTATGCCGATCG
R844    CGTTCAGACGTAGTGTGACGCGATCGGCATAACCACCAC
F863    CGTCACACTACGTCTGAACGTCGAAAACCCGAAACTGTGG
R883    TCGGGATTTCGGCGCTCCACAGTTTCGGGTTTTCGA
F903    AGCGCCGAAATCCCGAATCTCTATCGTGCGGTGGT
R919    GGCGGTGTGCAGTTCAACCACCGCACGATAGAGAT
F938    TGAACTGCACACCGCCGACGGCACGCTGATTGA
R954    CATCGCAGGCTTCTGCTTCAATCAGCGTGCCGTC
F971    AGCAGAAGCCTGCGATGTCGGTTTCCGCGAGGT
R988    GCAGACCATTTTCAATCCGCACCTCGCGGAAACCGA
F1004   GCGGATTGAAAATGGTCTGCTGCTGCTGAACGGCAA
R1024   CCTCGAATCAGCAACGGCTTGCCGTTCAGCAGCA
F1040   GCCGTTGCTGATTCGAGGCGTTAACCGTCACGAGCA
R1058   CTGACCATGCAGAGGATGATGCTCGTGACGGTTAACG
F1076   TCATCCTCTGCATGGTCAGGTCATGGATGAGCAGACGA
R1095   GCAGGATATCCTGCACCATCGTCTGCTCATCCATGAC
F1114   TGGTGCAGGATATCCTGCTGATGAAGCAGAACAACTTTAACG
R1132   TGCGAACAGCGCACGGCGTTAAAGTTGTTCTGCTTCATCA
F1156   CCGTGCGCTGTTCGCATTATCCGAACCATCCGCTG
R1172   CGCACAGCGTGTACCACAGCGGATGGTTCGGATAA
F1191   TGGTACACGCTGTGCGACCGCTACGGCCTGTA
R1207   TTGGCTTCATCCACCACATACAGGCCGTAGCGGT
F1223   TGTGGTGGATGAAGCCAATATTGAAACCCACGGCATGG
R1241   GGTCAGACGATTCATTGGCACCATGCCGTGGGTTTCAATA
F1261   TGCCAATGAATCGTCTGACCGATGATCCGCGCTGGC
R1281   TCGCTCATCGCCGGTAGCCAGCGCGGATCATC
F1297   TACCGGCGATGAGCGAACGCGTAACGCGAATGG
R1313   TTACGATCGCGCTGCACCATTCGCGTTACGCGT
F1330   TGCAGCGCGATCGTAATCACCCGAGTGTGATCATCT
R1346   TTCATTCCCCAGCGACCAGATGATCACACTCGGGTGA
F1366   GGTCGCTGGGGAATGAATCAGGCCACGGCGCTA
R1383   GATACAGCGCGTCGTGATTAGCGCCGTGGCCTGA
F1399   ATCACGACGCGCTGTATCGCTGGATCAAATCTGTCGATCC
R1417   CTGCACCGGGCGGGAAGGATCGACAGATTTGATCCAGC
F1439   TTCCCGCCCGGTGCAGTATGAAGGCGGCGGAGC
R1455   GGTGGCCGTGGTGTCGGCTCCGCCGCCTTCATA
F1472   CGACACCACGGCCACCGATATTATTTGCCCGATGTACGC
R1488   GGTCTTCATCCACGCGCGCGTACATCGGGCAAATAATATC
F1511   GCGCGTGGATGAAGACCAGCCCTTCCCGGCTGT
R1528   TTTTGATGGACCATTTCGGCACAGCCGGGAAGGGCT
F1544   GCCGAAATGGTCCATCAAAAAATGGCTTTCGCTACCTGG
R1564   CAGCGGGCGCGTCTCTCCAGGTAGCGAAAGCCATT
F1583   AGAGACGCGCCCGCTGATCCTTTGCGAATACGCCC
R1599   GACTGTTACCCATCGCGTGGGCGTATTCGCAAAGGAT
F1618   ACGCGATGGGTAACAGTCTTGGCGGTTTCGCTAAATACT
R1636   TGACGAAACGCCTGCCAGTATTTAGCGAAACCGCCAA
F1657   GGCAGGCGTTTCGTCAGTATCCCCGTTTACAGGGC
R1673   CAGTCCCAGACGAAGCCGCCCTGTAAACGGGGATAC
F1692   GGCTTCGTCTGGGACTGGGTGGATCAGTCGCTGATTA
R1709   GGGTTGCCGTTTTCATCATATTTAATCAGCGACTGATCCACC
F1729   AATATGATGAAAACGGCAACCCGTGGTCGGCTTACGGC
R1751   GCGTATCGCCAAAATCACCGCCGTAAGCCGACCAC
F1767   GGTGATTTTGGCGATACGCCGAACGATCGCCAGTTCT
R1786   GCAAAGACCAGACCGTTCATACAGAACTGGCGATCGTTCG
F1804   GTATGAACGGTCTGGTCTTTGCCGACCGCACGCCGCAT
R1826   CTTCCGTCAGCGCTGGATGCGGCGTGCGGTCG
F1842   CCAGCGCTGACGGAAGCAAAACACCAGCAGCAGTT
R1858   CCGGATAAACGGAACTGGAAAAACTGCTGCTGGTGTTTTG
F1877   TTTCCAGTTCCGTTTATCCGGGCAAACCATCGAAGTGACCAG
R1898   GCTATGACGGAACAGGTATTCGCTGGTCACTTCGATGGTTTGC
F1919   CGAATACCTGTTCCGTCATAGCGATAACGAGCTCCTGCACT
R1941   ATCCAGCGCCACCATCCAGTGCAGGAGCTCGTTATC
F1960   GGATGGTGGCGCTGGATGGTAAGCCGCTGGCAAG
R1977   CCAGAGGCACTTCACCGCTTGCCAGCGGCTTACC
F1994   CGGTGAAGTGCCTCTGGATGTCGCTCCACAAGGTAAA
R2011   TAGTTCAGGCAGTTCAATCAACTGTTTACCTTGTGGAGCGACAT
F2031   CAGTTGATTGAACTGCCTGAACTACCGCAGCCGGAGAGCG
R2055   GAGCCAGAGTTGCCCGGCGCTCTCCGGCTGCGG
F2071   CCGGGCAACTCTGGCTCACAGTACGCGTAGTGCAACC
R2088   ACCATGCGGTCGCGTTCGGTTGCACTACGCGTACTGT
F2108   GAACGCGACCGCATGGTCAGAAGCCGGGCACATC
R2125   CACTGCTGCCAGGCGCTGATGTGCCCGGCTTCTG
F2142   AGCGCCTGGCAGCAGTGGCGTCTGGCGGAAAACC
R2159   CGGGGAGCGTCACACTGAGGTTTTCCGCCAGACGC
F2176   TCAGTGTGACGCTCCCCGCCGCGTCCCACGCCAT
R2194   GGTGGTCAGATGCGGGATGGCGTGGGACGCGG
F2210   CCCGCATCTGACCACCAGCGAAATGGATTTTTGCATCG
R2226   CCAACGCTTATTACCCAGCTCGATGCAAAAATCCATTTCGCT
F2248   AGCTGGGTAATAAGCGTTGGCAATTTAACCGCCAGTCAGG
R2268   CCAATCCACATCTGTGAAAGAAAGCCTGACTGGCGGTTAAATTG
F2288   CTTTCTTTCACAGATGTGGATTGGCGATAAAAAACAACTGCTGACGC
R2312   AACTGATCGCGCAGCGGCGTCAGCAGTTGTTTTTTATCG
F2335   CGCTGCGCGATCAGTTCACCCGTGCACCGCTG
R2351   CACTTACGCCAATGTCGTTATCCAGCGGTGCACGGGTG
F2367   GATAACGACATTGGCGTAAGTGAAGCGACCCGCATTGA
R2389   CGACCCAGGCGTTAGGGTCAATGCGGGTCGCTT
F2405   CCCTAACGCCTGGGTCGAACGCTGGAAGGCGGC
R2422   GGCCTGGTAATGGCCCGCCGCCTTCCAGCGTT
F2438   GGGCCATTACCAGGCCGAAGCAGCGTTGTTGCAG
R2454   AAGTGTATCTGCCGTGCACTGCAACAACGCTGCTTC
F2472   TGCACGGCAGATACACTTGCTGATGCGGTGCTGA
R2490   GCGTGAGCGGTCGTAATCAGCACCGCATCAGC
F2506   TTACGACCGCTCACGCGTGGCAGCATCAGGGG
R2522   TTTCCGGCTGATAAATAAGGTTTTCCCCTGATGCTGCCAC
F2538   AAAACCTTATTTATCAGCCGGAAAACCTACCGGATTGATGGTAGT
R2562   ACGGTAATCGCCATTTGACCACTACCATCAATCCGGTAGGT
F2583   GGTCAAATGGCGATTACCGTTGATGTTGAAGTGGCGAGC
R2603   GCCGGATGCGGTGTATCGCTCGCCACTTCAACATCA
F2622   GATACACCGCATCCGGCGCGGATTGGCCTGAACT
R2639   TACCTGCGCCAGCTGGCAGTTCAGGCCAATCCGC
F2656   GCCAGCTGGCGCAGGTAGCAGAGCGGGTAAACTGG
R2673   GCGGCCCTAATCCGAGCCAGTTTACCCGCTCTGC
F2691   CTCGGATTAGGGCCGCAAGAAAACTATCCCGACCGC
R2707   CAAAACAGGCGGCAGTAAGGCGGTCGGGATAGTTTTCTT
F2727   CTTACTGCCGCCTGTTTTGACCGCTGGGATCTGCC
R2746   CGGGGTATACATGTCTGACAATGGCAGATCCCAGCGGT
F2762   ATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGA
R2784   GCAGCGCAGACCGTTTTCGCTCGGGAAGACGTA
F2801   AAACGGTCTGCGCTGCGGGACGCGCGAATTGA
R2817   CCACTGGTGTGGGCCATAATTCAATTCGCGCGTCCC
F2833   ATTATGGCCCACACCAGTGGCGCGGCGACTTCCAGTT
R2853   GACTGTAGCGGCTGATGTTGAACTGGAAGTCGCCGCG
F2870   CAACATCAGCCGCTACAGTCAACAGCAACTGATGGAAACCAG
R2890   TGCAGCAGATGGCGATGGCTGGTTTCCATCAGTTGCTGTT
F2912   CCATCGCCATCTGCTGCACGCGGAAGAAGGCACAT
R2930   TATGGAAACCGTCGATATTCAGCCATGTGCCTTCTTCCGCG
F2947   GGCTGAATATCGACGGTTTCCATATGGGGATTGGTGGCGAC
R2971   GACGGGCTCCAGGAGTCGTCGCCACCAATCCCCA
F2988   GACTCCTGGAGCCCGTCAGTATCGGCGGAATTCCAGC
R3005   GTAGCGACCGGCGCTCAGCTGGAATTCCGCCGATACT
F3025   TGAGCGCCGGTCGCTACCATTACCAGTTGGTCTGGTGTC
R3042   acggcagccgTTATTATTATTTTTGACACCAGACCAACTGGTAATG
F3064   AAAAATAATAATAAcggctgccgtggtagtatagggtgatgggca
F3088   tgcccatcaccctatactacc