The average Tm used for this computation is 66.2


Hybridization Map:
(Upper (+) strand is given 5' - 3', lower (-) strand is 3' - 5'. Numbers are hybridization Tm ([DNA] = 1.0E-6 M, [Na+] = 1.0 M))

ATGCCTAAAGTTTACAGTTAC-CAAGAAGTTGCCGAAC ACAATGGCCCAGAAAA-TTTCTGGATTATCATCGATG ACA
TACGGATTTCAAATGTCAATG GTTCTTCAACGGCTTG-TGTTACCGGGTCTTTT AAAGACCTAATAGTAGCTAC-TGT
62.916                63.84            64.6             63.91                62.

AAGTTTACGATGTTTC-TCAATTCAAAGATGAACATC CAGGTGGTGATGAAATT-ATAATGGATTTGGGTGGA CAAGA
TTCAAATGCTACAAAG AGTTAAGTTTCTACTTGTAG-GTCCACCACTACTTTAA TATTACCTAAACCCACCT-GTTCT
49               62.71                62.82             64.49              64.38

TGCTACAGAAAGC-TTTGTCGATATCGGTCA TTCTGACGAAGCATTGA-GACTACTGAAAGGTTTATACAT TGGTGAC
ACGATGTCTTTCG AAACAGCTATAGCCAGT-AAGACTGCTTCGTAACT CTGATGACTTTCCAAATATGTA-ACCACTG
              63.66             64.62             64.37                  67.07  

GTTGACAAGA-CCAGTGAGCGCGTTTC TGTGGAAAAGGTATCTACC-TCTGAAAACCAAAGTAAAGG TAGTGGTACAT
CAACTGTTCT GGTCACTCGCGCAAAG-ACACCTTTTCCATAGATGG AGACTTTTGGTTTCATTTCC-ATCACCATGTA
           69.56            65.04               64.76                64.2       

TGGTTGT-CATATTGGCCATTTTAATGC TAGGTGTTGCTTATTATTTGT-TGAACGAATAAgctcatc tatctgggta
ACCAACA GTATAACCGGTAAAATTACG-ATCCACAACGAATAATAAACA ACTTGCTTATTcgagtag-atagacccat
        64.54                64.31                 63.03              63.40     

ctagggt
gatccca
       


Statistics:
Min Tm is 62.49 °C
Avg Tm is 64.31 °C
Max Tm is 69.56 °C
Min hybridization unit size is 16 nucleotides
Avg hybridization unit size is 18.4 nucleotides
Max hybridization unit size is 22 nucleotides


Oligonucleotides to be synthesized:
(All sequence are 5'- 3'. R stand for reverse or (-) strand, F for forward or (+) strand. Sequence in lower case is extra sequence used for termination and does not belong to the input sequence)

R0      GTAACTGTAAACTTTAGGCAT
F0      ATGCCTAAAGTTTACAGTTACCAAGAAGTTGCCGAAC
R21     TTTTCTGGGCCATTGTGTTCGGCAACTTCTTG
F37     ACAATGGCCCAGAAAATTTCTGGATTATCATCGATG
R53     GAAACATCGTAAACTTTGTCATCGATGATAATCCAGAAA
F73     ACAAAGTTTACGATGTTTCTCAATTCAAAGATGAACATC
R92     AATTTCATCACCACCTGGATGTTCATCTTTGAATTGA
F112    CAGGTGGTGATGAAATTATAATGGATTTGGGTGGA
R129    GCTTTCTGTAGCATCTTGTCCACCCAAATCCATTAT
F147    CAAGATGCTACAGAAAGCTTTGTCGATATCGGTCA
R165    TCAATGCTTCGTCAGAATGACCGATATCGACAAA
F182    TTCTGACGAAGCATTGAGACTACTGAAAGGTTTATACAT
R199    TCTTGTCAACGTCACCAATGTATAAACCTTTCAGTAGTC
F221    TGGTGACGTTGACAAGACCAGTGAGCGCGTTTC
R238    GGTAGATACCTTTTCCACAGAAACGCGCTCACTGG
F254    TGTGGAAAAGGTATCTACCTCTGAAAACCAAAGTAAAGG
R273    ACAACCAATGTACCACTACCTTTACTTTGGTTTTCAGA
F293    TAGTGGTACATTGGTTGTCATATTGGCCATTTTAATGC
R311    ACAAATAATAAGCAACACCTAGCATTAAAATGGCCAATATG
F331    TAGGTGTTGCTTATTATTTGTTGAACGAATAAgctcatc
R352    accctagtacccagatagatgagcTTATTCGTTCA
R370    tatctgggtactagggt